Skip to content
 
 

Latest commit

 

History

1,186 Commits

Folders and files

NameName
Last commit message
Last commit date
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 

Repository files navigation

Congrats, you've made it to the repo for Teselagen's Open Source Vector Editor Component

  • Built With React & Redux
  • Built for easy extensibility + embed-ibility

Table of Contents

Upgrade Instructions for Major and Minor Versions

This repo follows semantic versioning (major/minor/patche)

The commit log can be seen here: https://github.com/TeselaGen/openVectorEditor/commits/master

Upgrade instructions for any major or minor change can be found here: Upgrade instructions

Using this module in React

Installation (react)

yarn add install-peerdeps open-vector-editor

Add peer-dependencies:

install-peerdeps open-vector-editor --dev --only-peers

Code (react)

Require the following components like:

import {Editor, RowView} from "open-vector-editor

Editor

The <Editor {...editorProps}/> component gives you a full blown editor. It takes in a list of editorProps as detailed below.

CircularView/CircularViewUnconnected

This gives you just the circular/plasmid map view. Either redux connected or unconnected (non-interactive)

LinearView/LinearViewUnconnected

This gives you just the linear map view. Either redux connected or unconnected (non-interactive)

RowView/RowViewUnconnected

This gives you just the detailed view of the sequence rows. Either redux connected or unconnected (non-interactive)

EnzymeViewer

A component used for viewing enzymes

Using this module outside of react apps (Universal):

The universal build can be used in any app with or without react. It corresponds to using the component in the React version. You will be able to customize the Editor just like in the react build, but you will not be able to use the individual components like or . For that you'll need to use React.

Installation (Universal)

via npm:

npm install open-vector-editor

then add the links

<link rel="stylesheet" type="text/css" href="your-path-to-node-modules/open-vector-editor/umd/main.css">
<script type="text/javascript" src="your-path-to-node-modules/open-vector-editor/umd/open-vector-editor.js"></script>

Or via CDN:

<link rel="stylesheet" type="text/css" href="https://unpkg.com/open-vector-editor/umd/main.css"> 
<script type="text/javascript" src="https://unpkg.com/open-vector-editor/umd/open-vector-editor.js"></script>

Code (Universal)

<script>
const editor = window.createVectorEditor(yourDomNodeHere, editorProps);
editor.updateEditor(editorState);	
</script>

editorProps

These props consist of hooks and editor config options that can be passed like so: <Editor {...editorProps}/> or as seen above like window.createVectorEditor(yourDomNodeHere, editorProps);

{
	shouldAutosave: true, //by default the editor does not autosave, setting this to true will trigger the onSave callback after any change to the sequenceData
	onSave: function(event, sequenceDataToSave, editorState, onSuccessCallback) {
		console.info("event:", event);
		console.info("sequenceData:", sequenceDataToSave);
		console.info("editorState:", editorState);
		// To disable the save button after successful saving
		// either call the onSuccessCallback or return a successful promise :)
		onSuccessCallback()
		//or 
		// return myPromiseBasedApiCall()
	},
	onCopy: function(event, copiedSequenceData, editorState) {
		//the copiedSequenceData is the subset of the sequence that has been copied in the teselagen sequence format
		console.info("event:", event);
		console.info("sequenceData:", copiedSequenceData);
		console.info("editorState:", editorState);
		const clipboardData = event.clipboardData;
		clipboardData.setData("text/plain", copiedSequenceData.sequence);
		clipboardData.setData(
			"application/json",
			JSON.stringify(copiedSequenceData)
		);
		event.preventDefault();
		//in onPaste in your app you can do:
		// e.clipboardData.getData('application/json')
	},
	onPaste: function(event, editorState) {
		//the onPaste here must return sequenceData in the teselagen data format
		const clipboardData = event.clipboardData;
		let jsonData = clipboardData.getData("application/json")
		if (jsonData) {
			jsonData = JSON.parse(jsonData)
			if (jsonData.isJbeiSeq) {
				jsonData = convertJbeiToTeselagen(jsonData)
			}
		}
		const sequenceData = jsonData || {sequence: clipboardData.getData("text/plain")}
		return sequenceData
	},
	//regular click overrides, eg: 
	featureClicked: ({annotation, event}) => {
		//do something here :)
	}
	// orf/primer/translation/cutsite/translationDouble/deletionLayer/replacementLayer/feature/part/searchLayer xxxxClicked can also be overridden

	rightClickOverrides: { //override what happens when a given feature/part/primer/translation/orf/cutsite/selectionLayer/lineageLine gets right clicked
		//the general format is xxxxRightClicked eg:
		selectionLayerRightClicked: (items, {annotation}, props) => {
			return [...items, { 
				//props here get passed directly to blueprintjs MenuItems
				text: "Create Part",
				onClick: () => console.info('hey!≈')
			}]
		}
	},
	PropertiesProps: { 
		// the list of tabs shown in the Properties panel
		propertiesList: [
			"general",
			"features",
			"parts",
			"primers",
			"translations",
			"cutsites",
			"orfs",
			"genbank"
		]
	},
	ToolBarProps: {
			toolList: [
				"saveTool",
				//you can override a tool like so:
				{name: "downloadTool", Dropdown: () => { 
					return "Hey!"
				}},
				"importTool",
				"undoTool",
				"redoTool",
				"cutsiteTool",
				"featureTool",
				"alignmentTool",
				// "oligoTool",
				"orfTool",
				// "viewTool",
				"editTool",
				"findTool",
				"visibilityTool"
				// "propertiesTool"
			]
		}
		onDigestSave: () => {} //tnr: NOT YET IMPLEMENTED
}

editorState

These are the options to the updateEditor() action (the most generic redux action we have)) and will cause the editor state stored in redux to be updated. Only the subset of options that are passed will be updated.

{

	//note, sequence data passed here will be coerced to fit the Teselagen data model
	sequenceData: { Open Vector Editor data model
		sequence: "atagatagagaggcccg",
		features: [
			{
				color: "#b3b3b3", //you can override the default color for each individual feature if you want
				type: "misc_feature",
				start: 0, //start and end are 0-based inclusive for all annotations
				end: 10,
				id: 'yourUniqueID',
				forward: true //ie true=positive strand     false=negative strange 
			}
		],
		parts: []
	},
	annotationVisibility: {
		features: false
	},
	panelsShown: [
		[
			{
				id: "sequence",
				name: "Sequence Map",
				active: true
			}
		],
		[
			{
				id: "circular",
				name: "Plasmid",
				active: true
			},
			{
				id: "rail",
				name: "Linear Map",
				active: false
			},
			{
				id: "properties",
				name: "Properties",
				active: false
			}
		]
	],
	caretPosition: 10,
	...additional editor props can be passed here [Example Editor State](./editorStateExample.js)
}

Data Model

The data model can be interactively inspected by installing the redux devtools for your browser: devtools Here is the top level editor state: Example Editor State

Alignments

Integrating your own alignment data (only necessary if not using the built in alignment creation tool)

Add a panel to the panelsShown prop like so:

window.createAlignmentView(this.node, {
	id: "jbeiAlignment1", //give your alignment a unique id
	////optional! Use if you want a pairwise alignment:
	pairwiseAlignments: [  // this is an array of [referenceSequence, alignedSequence]
		[
			{ //reference sequence must come first!
				sequenceData: {
					id: "FWER1231", //every sequenceData and alignmentData should have a unique id
					name: "GFPuv58",
					sequence:	"ttgagggg",
					features: [{id: "feat1", start: 2, end:4, name: "GFP CDS"}]
				},
				alignmentData: {
					sequence:	"ttgag--ggg--" //this length should be the same as the below alignmentData length!
				}
			},{ //aligned sequence must come second!
				sequenceData: {
					name: "GFPuv58",
					sequence:	"gagccgggtt"
				},
				alignmentData: {
					sequence:	"--gagccgggtt" //this length should be the same as the above alignmentData length!
				}
			}
		]
		[
			{Alignment Track Data Here}, //reference sequence track (see Data Model below for specs)
			{Alignment Track Data Here}, //aligned sequence track (see Data Model below for specs)
		],
		[
			{Alignment Track Data Here}, //see Data Model below for specs
			{Alignment Track Data Here}, 
		],
	]
	////optional! Use if you want a multi-seq alignment:
	alignmentTracks: [ 
		{Alignment Track Data Here}, //see Data Model below for specs
		{Alignment Track Data Here},
		{Alignment Track Data Here},
	],
	//additional view options: 

	"alignmentAnnotationVisibility": {
        "features": true,
        "yellowAxis": false,
        "translations": false,
        "parts": true,
        "orfs": true,
        "orfTranslations": false,
        "axis": true,
        "cutsites": false,
        "primers": true,
        "reverseSequence": false,
        "lineageLines": true,
        "axisNumbers": true
    },
    "alignmentAnnotationLabelVisibility": {
        "features": true,
        "parts": true,
        "cutsites": false
    },
});

Alignment Track Data Model

Note: alignmentData.sequence is assumed to be the same length for EVERY track within an alignment run or a pairwise alignment sub-alignment!

alignmentData can contain "-" characters, whereas sequenceData should not. Sequence Data is the "raw" data of the sequence being aligned with features/parts/etc.

{
	//JBEI sequence 'GFPuv58'
	// chromatogramData: ab1ParsedGFPuv58,
	sequenceData: {
		id: "2",
		name: "GFPuv58",
		sequence:
			"GTTCAATGCTTTTCCCGTTATCCGGATCATATGAAACGGCATGACTTTTTCAAGAGTGCCATGCCCGAAGGTTATGTACAGGAACGCACTATATCTTTCAAAGATGACGGGAACTACAAGACGCGTGCTGAAGTCAAGTTTGAAGGTGATACCCTTGTTAATCGTATCGAGTT"
	},
	alignmentData: {
		id: "2",
		sequence:
			"GTTCAA--TGCTTTTCCCGTTATCCGGATCATATGAAACGGCATGACTTTTTCAAGAGTGCCATGCCCGAAGGTTATGTACA---GGAACGCACTATATCTTTCAAAGATGACGGGAACTACAAGACGCGTGCTGAAGTCAAGTTTGAAGGTGATAC--CCTTGTTAATCGTATCGAGTT--"
	}
}

Chromatogram Data

"chromatogramData": { //only if parsing in an ab1 file
      "aTrace": [], //same as cTrace but for a
      "tTrace": [], //same as cTrace but for t
      "gTrace": [], //same as cTrace but for g
      "cTrace": [0,0,0,1,3,5,11,24,56,68,54,30,21,3,1,4,1,0,0, ...etc], //heights of the curve spaced 1 per x position (aka if the cTrace.length === 1000, then the max basePos can be is 1000)
      "basePos": [33, 46, 55,], //x position of the bases (can be unevenly spaced)
      "baseCalls": ["A","T", ...etc],
      "qualNums": [],
    },

Implementing Autosave functionality

Development:

Prerequisites

Node.js >= v4 must be installed.

Installation

yarn
yarn start

About

Teselagen's Open Source Vector Editor Component

Resources

Stars

0 stars

Watchers

0 watching

Forks

Releases

Packages

Contributors

Languages